Skip to content
 
 

Latest commit

 

History

134 Commits

Folders and files

NameName
Last commit message
Last commit date
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 

Repository files navigation

CompAIRR

CompAIRR (compairr) is a command line tool to compare two sets of adaptive immune receptor repertoires and compute their overlap. It can also identify which sequences are present in which repertoires. Furthermore, CompAIRR can cluster the sequences in a repertoire set. Sequence comparisons can be exact or approximate. CompAIRR has been shown to be very fast and to have a small memory footprint compared to similar tools, when up to 2 differences are allowed.

Installation

The code is C++11 standard compliant and should compile easily using make and a modern C++ compiler (e.g. GNU GCC or LLVM Clang). Run make clean, make, make test and make install in the main folder to clean, build, test and install the tool. There are no dependencies except for the C and C++ standard libraries.

Binaries for Linux (x86_64) and macOS (x86_64 and Arm64) are also distributed with each release.

A Dockerfile is included if you want to make a Docker image. A docker image may be built with the following command:

docker build -t compairr .

Ready-made Docker images for CompAIRR can be found on the Docker Hub.

CompAIRR can be installed on macOS using homebrew with brew install torognes/bioinf/compairr.

Tutorial

For an introduction to how to use CompAIRR, please have a look at the CompAIRR tutorial.

General options

Use the -h or --help option to show some help information.

Run the program with -v or --version for version information.

The type of operation that should be performed is specified with one of the options -m, -x, -c or -z (or the corresponding long option forms --matrix, --existence, --cluster, or --deduplicate).

The code is multi-threaded. The number of threads may be specified with the -t or --threads option.

The results will be written to standard out (stdout) unless a file name has been specified with the -o or --output-file option.

While the program is running it will print some status and progress information to standard error (stderr) unless a log file has been specified with the -l or --log option. Error messages and warnings will also be written here.

The default is to compare amino acid sequences, but nucleotide sequences are compared if the -n or --nucleotides option is given. The accepted amino acid symbols are ACDEFGHIKLMNPQRSTVWY, while the accepted nucleotide symbols are ACGTU. Lower case letters are also accepted. The program will abort with an error message if any other symbol is encountered in a sequence, unless one specifies the -u or --ignore-unknown option, in which case CompAIRR will simply ignore that sequence. If the program encounters an empty sequence it will also abort with an error message, unless the -e or --ignore-empty option is given.

By default, the sequences should be given in the junction or junction_aa column of the input file, for nucleotide and amino acid sequences, respectively. Alternatively, the sequences may be present in the cdr3 or cdr3_aa column, if the --cdr3 option is given.

The user can specify how many differences are allowed when comparing sequences, using the option -d or --differences. To allow indels (insertions or deletions) the option -i or --indels may be specified, otherwise only substitutions are allowed. By default, no differences are allowed. The -i option is allowed only when d=1. The number of differences allowed strongly influences the speed of CompAIRR. The program will be slower as more differences are allowed. When d=0 or d=1 it is very fast, but it will be relatively slow with d=2 and even slower when d>2. See the section on performance below for an example.

The V and J gene alleles specified for each sequence must also match, unless the -g or --ignore-genes option is in effect.

Computing overlap between two repertoire sets

To compute the overlap between two repertoire sets, use the -m or --matrix option.

For each of the two repertoire sets there must an input file of tab-separated values formatted according to the AIRR standard for rearrangements. The two input files are specified on the command line without any preceding option letter. If only one filename is specified on the command line, or the same filename is specified twice, it is assumed that the set should be compared to itself. Each file must contain the repertoire ID and either the nucleotide or the amino acid sequence of the rearrangement. If the repertoire ID column is missing, all sequences are assumed to belong to the same repertoire (with ID 1 or 2, respectively, for the two sets). A sequence ID may also be included. Unless they should be ignored, the V gene, the J gene, and the duplicate count is also needed.

Each set can contain many repertoires and each repertoire can contain many sequences. The tool will find the sequences in the two sets that are similar and output a matrix with results.

CompAIRR assumes that all sequences within each repertoire are distinct, and that the abundance of each sequence is indicated in the duplicate_count field in the input file. Duplicated sequences, i.e. identical sequences (with the same V and J genes) within the same repertoire, may lead to unexpected results. CompAIRR will warn if it detects duplicates. Duplicates may be merged with the --deduplicate command.

The similar sequences of each repertoire in each set are found by comparing the sequences and their V and J genes. The duplicate count of each sequence is taken into account and a matrix is output containing a value for each combination of repertoires in the two sets. The value is usually the sum of the products of the duplicate counts of all pairs of sequences in the two repertoires that match. If the option -f or --ignore-counts is specified, the duplicate count information is ignored and all counts are treated as 1. Instead of summing the product of the counts, the ratio, min, max, or mean may be used if specified with the -s or --score option. The Morisita-Horn index or Jaccard index will be calculated if MH or Jaccard is specified with the -s option. These indices can only be computed when d=0.

The output will be a matrix of values in a tab-separated plain text file. Two different formats can be selected. In the default format, the first line contains the hash character (#) followed by the repertoire ID's from the second set. The following lines contains the repertoire ID from the first set, followed by the values corresponding to the comparison of this repertoire with each of the repertoires in the second set.

An alternative output format is used when the -a or --alternative option is specified. It will write the results in a three column format with the repertoire ID from set 1 and set 2 in the two first columns, respectively, and the value in the third column. There will be one line for each combination of repertoires in the sets. The very first line will contain a hash character (#) followed by the field names separated by tabs.

If the -p or --pairs option is specified, CompAIRR will write information about all pairs of matching sequences to a specified TSV file. Please note that such files may grow very large when there are many matches. Use of multithreading may be of little use in this case. The order of the lines in the file is unspecified. The following columns from both input files will be included in the output: repertoire_id, sequence_id, duplicate_count, v_call, j_call, and junction. The term junction will be replaced with junction_aa, cdr3, or cdr3_aa as appropriate. Additional columns from the input files may be copied to the pairs file using the -k or --keep-columns option. Multiple columns, separated by commas (but no spaces), may be given. A warning will be given if any of the specified columns are missing. In the header, columns from the first and second input file will be suffixed by _1 and _2, respectively. The distance between the sequences will be included if the --distance option is included. This is usually the Hamming distance (minimum number of substitutions), unless the --indel (or -i) option is specified, in which case the distance is the Levenshtein distance (minimum number of substitutions or indels). If only the information in the pairs file is required, and not the information in the matrix, the storage and output of the matrix can be avoided with the --no-matrix option. This may save some memory and time if there are many repertoires in the sets.

Analysing in which repertoires a set of sequences are present

Use the option -x or --existence to analyse in which repertoires a set of sequences are present, and create a sequence presence matrix.

Two input files with repertoire sets in standard format must be specified on the command line. The first file should contain the different sequences to analyse. The sequence_id column must be present in this file. If the optional repertoire_id column is present, all those identifiers must be identical. The second file must contain the repertoires to match. The repertoire_id column must be present in the second file, otherwise the ID will be set to 2 for all sequences.

CompAIRR will identify in which repertoires each sequence is present and will output the results either as a matrix or as a three-column table (if the -a option is specified). The options -d, -i, -g, and -n (and the corresponding long option names --differences, --indels, --ignore-genes, and --nucleotides) will be taken into account when comparing sequences.

The output will be in a similar format as when computing the overlap (above), but the first column will contain the sequence_id from the first file instead of the repertoire_id.

The -p or --pairs option may be specified to output all pairs of matching sequences in the same way as for the overlap computation.

Clustering the sequences in a repertoire

To cluster the sequences in one repertoire, use the -c or --cluster option.

One input file in tab-separated format must be specified on the command line.

The tool will cluster the sequences using single linkage hierarchical clustering, according to the specified distance and indel options (-d, --distance, -i, --indels). The V and J gene alleles will be taken into account unless the -g or --ignore-genes option is specified. The options -n or --nucleotides indicate that the comparison should be performed with nucleotide sequences, not amino acid sequences. If the repertoire ID column is missing, all sequences are assumed to belong to the same repertoire (with ID 1).

The output will be in a similar TSV format as the input file, but preceded with two additional columns. The first column will contain a cluster number, starting at 1. The second column will contain the size of the cluster. The subsequent columns are repertoire_id, sequence_id, duplicate_count, v_call, j_call, and junction (or junction_aa, cdr3 or cdr3_aa, as appropriate).

The clusters are sorted by size, in descending order.

Deduplication

The --deduplicate command may be used to deduplicate a data set by merging entries in the same repertoire with identical sequences and identical V and J genes. This may be necessary to get correct results when computing overlaps between repertoires. Duplicates may be present for instance in cases were the data set contains both nucleotide and amino acid sequences from the same rearrangement, where the nucleotide sequences may be distinct while the amino acid sequences may not be, due to the degeneracy of the genetic code.

One input file in TSV format must be specified on the command line.

Strictly identical sequences in the same repertoire will be merged and their counts will be added together. If the -g or --ignore_genes option is specified, the V and J genes are ignored. The -n or --nucleotides option may be specified if the input is nucleotide sequences, otherwise amino acid sequences will be assumed. If the -f or --ignore_counts option is specified, the counts in the input file will be ignored, and just the number of identical sequences will be counted. If the repertoire ID column is missing, all sequences are assumed to belong to the same repertoire (with ID 1).

The output will be in a similar TSV format as the input file, with the following columns: repertoire_id, duplicate_count, v_call, j_call, and junction (or junction_aa, cdr3 or cdr3_aa, as appropriate). If the -g or --ignore_genes option is specified, the v_call and j_call columns will not be included.

Input files

The input files must be in tab-separated value (TSV) format accoring to the Rearrangement Schema of the AIRR standards 1.3 documentation.

The first line must contain the header. The rest of the file must contain one line per sequence. The following fields should be included:

  • repertoire_id: identifier of the repertoire
  • sequence_id: identifier of the sequence (optional except for for first file when using -x or --existence)
  • duplicate_count: number of identical copies of the same rearrangement (required unless -f option given)
  • v_call: V gene name with allele (required unless -g option given)
  • j_call: J gene name with allele (required unless -g option given)
  • junction: nucleotide sequence (required if -n option given and --cdr3 option not given)
  • junction_aa: amino acid sequence (single letter code) (required unless -n or --cdr3 options given)
  • cdr3: nucleotide sequence (required if both -n and --cdr3 options given)
  • cdr_aa: amino acid sequence (single letter code) (required if --cdr3 option given and -n option not given)

See below for an example. Other fields may be included, but will be ignored.

Command line option overview

The command line should look like this:

compairr OPTIONS TSVFILE1 [TSVFILE2]

Exactly one of the command options -m, -x or -c (or their long forms) must be specified. Other options as indicated in the table below could also be included. With the -m and -x command options, the names of two tab-separated value files with repertoires must also be specified on the command line, with the -c command option, only one such file should be specified.

Short Long Argument Default Description
-a --alternative Output results in three-column format, not matrix
--cdr3 Use the cdr3 or cdr3_aa column instead of junction or junction_aa
-c --cluster Cluster sequences in one repertoire
-d --differences INTEGER 0 Number of differences accepted
--distance Include sequence distance in pairs file
-e --ignore-empty Ignore empty sequences
-f --ignore-counts Ignore duplicate count information
-g --ignore-genes Ignore V and J gene information
-h --help Display help text and exit
-i --indels Allow insertions or deletions
-k --keep-columns STRING Copy given comma-separated columns to pairs file
-l --log FILENAME (stderr) Log to specified file instead of stderr
-m --matrix Compute overlap matrix between two sets
--no-matrix Do not keep or output any matrix
-n --nucleotides Compare nucleotides, not amino acids
-o --output FILENAME (stdout) Output results to specified file instead of stdout
-p --pairs FILENAME (none) Output matching pairs to specified file
-s --score STRING product Sum product, ratio, min, max, or mean; or compute MH or Jaccard index
-t --threads INTEGER 1 Number of threads to use (1-256)
-u --ignore-unknown Ignore sequences including unknown residue symbols
-v --version Display version information
-x --existence Check existence of sequences in repertoires
-z --deduplicate Deduplicate sequences

Example 1: Repertoire overlap

In this example we will compute the overlap of two repertoire sets.

Let's use two simple input files. The first is seta.tsv:

repertoire_id	sequence_id	duplicate_count	v_call	j_call	junction	junction_aa	sequence	rev_comp	productive	d_call	sequence_alignment	germline_alignment	v_cigar	d_cigar	j_cigar
A1	R	1	TCRBV07-06	TCRBJ02-01	tgcgcgagcagcaccagccatgaacagtatttt	CASSTSHEQYF									
A2	S	3	TCRBV07-09	TCRBJ01-02	tgcgcgagcagcctgcgcgtgggcggctatggctataccttt	CASSLRVGGYGYTF									

The second is setb.tsv:

repertoire_id	sequence_id	duplicate_count	v_call	j_call	junction	junction_aa	sequence	rev_comp	productive	d_call	sequence_alignment	germline_alignment	v_cigar	d_cigar	j_cigar
B1	T	5	TCRBV07-09	TCRBJ01-02	tgcgcgagcagcctgcgcgtgggcggctatggctataccttt	CASSLRVGGYGYTF									
B1	U	10	TCRBV07-09	TCRBJ01-02	tgcgcgagcagcctgcgcgtgggcggctttggctataccttt	CASSLRVGGFGYTF									
B2	V	7	TCRBV07-06	TCRBJ02-01	tgcgcgagcagcaccagccatcagcagtatttt	CASSTSHQQYF									

We run the following command:

compairr -m seta.tsv setb.tsv -d 1 -o output.tsv -p pairs.tsv

Here is the output to the console:

CompAIRR 1.7.0 - Comparison of Adaptive Immune Receptor Repertoires
https://github.com/uio-bmi/compairr

Start time:        Thu Mar 03 12:29:32 CET 2022
Command (m/c/x):   Overlap (-m)
Repertoire set 1:  seta.tsv
Repertoire set 2:  setb.tsv
Nucleotides (n):   No
Differences (d):   1
Indels (i):        No
Ignore counts (f): No
Ignore genes (g):  No
Ign. unknown (u):  No
Threads (t):       1
Output file (o):   output.tsv
Output format (a): Matrix
Score (s):         Sum of products of counts
Pairs file (p):    pairs.tsv
Log file (l):      (stderr)

Immune receptor repertoire set 1

Reading sequences: 100% (0s)
Repertoires:       2
Sequences:         2
Residues:          25
Shortest:          11
Longest:           14
Average length:    12.5
Total dupl. count: 4
Indexing:          100% (0s)

Repertoires in set:
# Sequences Count Repertoire ID
1         1     1 A1
2         1     3 A2

Immune receptor repertoire set 2

Reading sequences: 100% (0s)
Repertoires:       2
Sequences:         3
Residues:          39
Shortest:          11
Longest:           14
Average length:    13.0
Total dupl. count: 22
Indexing:          100% (0s)

Repertoires in set:
# Sequences Count Repertoire ID
1         2    15 B1
2         1     7 B2

Unique V genes:    2
Unique J genes:    2
Computing hashes:  100% (0s)
Computing hashes:  100% (0s)
Hashing sequences: 100% (0s)
Analysing:         100% (0s)
Writing results:   100% (0s)

End time:          Thu Mar 03 12:29:32 CET 2022

Repertoires will be sorted alphabetically by ID. The program gives some statistics on the input files after reading them.

Here is the result in the output.tsv file:

#	B1	B2
A1	0	7
A2	45	0

And here is the result in the pairs.tsv file:

#repertoire_id_1	sequence_id_1	duplicate_count_1	v_call_1	j_call_1	junction_aa_1	repertoire_id_2	sequence_id_2	duplicate_count_2	v_call_2	j_call_2	junction_aa_2
A1	R	1	TCRBV07-06	TCRBJ02-01	CASSTSHEQYF	B2	V	7	TCRBV07-06	TCRBJ02-01	CASSTSHQQYF
A2	S	3	TCRBV07-09	TCRBJ01-02	CASSLRVGGYGYTF	B1	T	5	TCRBV07-09	TCRBJ01-02	CASSLRVGGYGYTF
A2	S	3	TCRBV07-09	TCRBJ01-02	CASSLRVGGYGYTF	B1	U	10	TCRBV07-09	TCRBJ01-02	CASSLRVGGFGYTF

Here, sequence R in repertoire A1 is similar to sequence V in repertoire B2. The only difference is the E and Q in the 8th position. The gene allele names are also the same. They have duplicate counts of 1 and 7, respectively. The product is 7. That value is found in the third column on the second line in the main output file.

Sequence S in repertoire A2 with duplicate count 3 is similar to both sequence T and U in repertoire B1, with duplicate counts of 5 and 10, respectively. Sequence T in B1 is identical, while sequence U in B1 has an F instead of a Y in the 10th position. The result is 3 * (5 + 10) = 3 * 15 = 45. That value is found in the second column on the third line of the main output file.

Since there are no sequences from repertoire A1 similar to B1 or from A2 similar to B1, the other values in the matrix are zero.

This small dataset is included in the test folder and the tool can automatically be tested by running make test.

Example 2: Sequence existence

In this example we will use the -x or --existence option to find out in which repertoires a set of sequences are present.

The file setc.tsv contains the sequences that we will analyse:

repertoire_id	sequence_id	duplicate_count	v_call	j_call	junction	junction_aa	sequence	rev_comp	productive	d_call	sequence_alignment	germline_alignment	v_cigar	d_cigar	j_cigar
C	X	1	TCRBV07-09	TCRBJ01-02	tgcgcgagcagcctgcgcgtgggcggctttggctataccttt	CASSLRVGGFGYTF									
C	Y	1	TCRBV07-06	TCRBJ02-01	tgcgcgagcagcaccagccatcagcagtatttt	CASSTSHQQYF									

The file above is included in the folder test in the distribution.

We will compare it to repertoire sets in the file setb.tsv described earlier.

We run the following command:

compairr -x setc.tsv setb.tsv -d 1 -f -o output.tsv -p pairs.tsv

Here is the output to the console:

CompAIRR 1.7.0 - Comparison of Adaptive Immune Receptor Repertoires
https://github.com/uio-bmi/compairr

Start time:        Thu Mar 03 12:31:16 CET 2022
Command (m/c/x):   Existence (-x)
Repertoire:        setc.tsv
Repertoire set:    setb.tsv
Nucleotides (n):   No
Differences (d):   1
Indels (i):        No
Ignore counts (f): Yes
Ignore genes (g):  No
Ign. unknown (u):  No
Threads (t):       1
Output file (o):   output.tsv
Output format (a): Matrix
Score (s):         Sum of products of counts
Pairs file (p):    pairs.tsv
Log file (l):      (stderr)

Immune receptor repertoire set 1

Reading sequences: 100% (0s)
Repertoires:       1
Sequences:         2
Residues:          25
Shortest:          11
Longest:           14
Average length:    12.5
Total dupl. count: 2
Indexing:          100% (0s)

Repertoires in set:
# Sequences Count Repertoire ID
1         2     2 C

Immune receptor repertoire set 2

Reading sequences: 100% (0s)
Repertoires:       2
Sequences:         3
Residues:          39
Shortest:          11
Longest:           14
Average length:    13.0
Total dupl. count: 22
Indexing:          100% (0s)

Repertoires in set:
# Sequences Count Repertoire ID
1         2    15 B1
2         1     7 B2

Unique V genes:    2
Unique J genes:    2
Computing hashes:  100% (0s)
Computing hashes:  100% (0s)
Hashing sequences: 100% (0s)
Analysing:         100% (0s)
Writing results:   100% (0s)

End time:          Thu Mar 03 12:31:16 CET 2022

Here is the result in the output.tsv file:

#	B1	B2
X	2	0
Y	0	1

Please note that the -f option was used to ignore the duplicate counts.

And here is the result in the pairs.tsv file:

#repertoire_id_1	sequence_id_1	duplicate_count_1	v_call_1	j_call_1	junction_aa_1	repertoire_id_2	sequence_id_2	duplicate_count_2	v_call_2	j_call_2	junction_aa_2
C	X	1	TCRBV07-09	TCRBJ01-02	CASSLRVGGFGYTF	B1	U	10	TCRBV07-09	TCRBJ01-02	CASSLRVGGFGYTF
C	X	1	TCRBV07-09	TCRBJ01-02	CASSLRVGGFGYTF	B1	T	5	TCRBV07-09	TCRBJ01-02	CASSLRVGGYGYTF
C	Y	1	TCRBV07-06	TCRBJ02-01	CASSTSHQQYF	B2	V	7	TCRBV07-06	TCRBJ02-01	CASSTSHQQYF

The results indicate that sequence X was found (twice) in repertoire B1 (matching sequences T and U) and that sequence Y was found in repertoire B2 (matching sequence V).

Example 3: Clustering sequences

This time we will cluster the nucleotide sequences in the file setb.tsv using the -c or --cluster option.

The command line to run is:

compairr -c setb.tsv -d 1 -n -o output.tsv

The output during the clustering is as follows:

CompAIRR 1.7.0 - Comparison of Adaptive Immune Receptor Repertoires
https://github.com/uio-bmi/compairr

Start time:        Thu Mar 03 12:33:05 CET 2022
Command (m/c/x):   Cluster (-c)
Repertoire:        setb.tsv
Nucleotides (n):   Yes
Differences (d):   1
Indels (i):        No
Ignore counts (f): No
Ignore genes (g):  No
Ign. unknown (u):  No
Threads (t):       1
Output file (o):   output.tsv
Log file (l):      (stderr)

Immune receptor repertoire clustering

Reading sequences: 100% (0s)
Repertoires:       2
Sequences:         3
Residues:          117
Shortest:          33
Longest:           42
Average length:    39.0
Total dupl. count: 22
Indexing:          100% (0s)

Unique V genes:    2
Unique J genes:    2

Computing hashes:  100% (0s)
Hashing sequences: 100% (0s)
Building network:  100% (0s)
Clustering:        100% (0s)
Sorting clusters:  100% (0s)
Writing clusters:  100% (0s)

Clusters:          2
End time:          Thu Mar 03 12:33:05 CET 2022

The result in the file output.tsv looks like this:

#cluster_no	cluster_size	repertoire_id	sequence_id	duplicate_count	v_call	j_call	junction
1	2	B1	T	5	TCRBV07-09	TCRBJ01-02	tgcgcgagcagcctgcgcgtgggcggctatggctataccttt
1	2	B1	U	10	TCRBV07-09	TCRBJ01-02	tgcgcgagcagcctgcgcgtgggcggctttggctataccttt
2	1	B2	V	7	TCRBV07-06	TCRBJ02-01	tgcgcgagcagcaccagccatcagcagtatttt

In this case, there are 2 clusters. The first contains 2 sequences (T and U from B1), while the second cluster contains 1 sequence (V from B2). The sequences are clustered across repertoires.

Example 4: Deduplication

This time we will deduplicate the amino acid sequences in the file setb.tsv using the -z or --deduplicate option.

The command line to run is:

compairr -z setb.tsv -o output.tsv

The output will look like this:

CompAIRR 1.8.0 - Comparison of Adaptive Immune Receptor Repertoires
https://github.com/uio-bmi/compairr

Start time:        Thu Sep 15 17:10:51 CEST 2022
Command:           Deduplicate (--deduplicate)
Repertoire:        setb.tsv
Nucleotides (n):   No
Differences (d):   0
Indels (i):        No
Ignore counts (f): No
Ignore genes (g):  No
Ign. unknown (u):  No
Threads (t):       1
Output file (o):   output.tsv
Log file (l):      (stderr)

Reading sequences: 100% (0s)
Repertoires:       2
Sequences:         3
Residues:          39
Shortest:          11
Longest:           14
Average length:    13.0
Total dupl. count: 22
Indexing:          100% (0s)
Unique V genes:    2
Unique J genes:    2
Computing hashes:  100% (0s)
Deduplicating:     100% (0s)
Duplicates merged: 0
Writing output:    100% (0s)

End time:          Thu Sep 15 17:10:51 CEST 2022

The result in the file output.tsv looks like this:

repertoire_id	duplicate_count	v_call	j_call	junction_aa
B1	5	TCRBV07-09	TCRBJ01-02	CASSLRVGGYGYTF
B1	10	TCRBV07-09	TCRBJ01-02	CASSLRVGGFGYTF
B2	7	TCRBV07-06	TCRBJ02-01	CASSTSHQQYF

There were no duplicates in this dataset so the output is essentially identical to the input data, but does not include all the original columns. If the two sequences in repertoire B1 had been identical, the two lines would have been merged and the new duplicate_count would have been 15.

Implementation

The program is written in C++. The strategy for finding similar sequences is based on a similar concept developed for the tool Swarm (Mahé et al. 2021). Basically, a 64-bit hash is computed for all sequences in the sets. All hashes for one set are stored in a Bloom filter and in a hash table. We then look for matches to sequences in the second set by looking them up in the Bloom filter and then, if there was a match, in the hash table. To find matches with 1 or 2 substitutions or indels, the hashes of all these variant sequences are generated and looked up. When d>2, a different strategy is used where all sequences are compared against each other and the number of differences is found.

Performance

As a preliminary performance test, Cohort 2 ("Keck") of the dataset by Emerson et al. (2017) was compared to itself. It contains 120 repertoires with a total of 24 205 557 extracted sequences. The test was performed with CompAIRR version 1.3.1. The timing results are shown below.

Distance Indels Threads Time (s) Time (mm:ss)
0 no 1 18 0:18
0 no 4 12 0:12
1 no 1 224 3:44
1 no 4 72 1:12
1 yes 1 367 6:07
1 yes 4 111 1:51
2 no 4 3200 53:20

When the distance is zero almost all of the time was used to read files.

Memory usage was 2.5GB, corresponding to an average of about 100 bytes per sequence.

Since this is a comparison of a repertoire set to itself, the dataset is only read once, and the memory needed is also reduced as compared to a situation were two different repertoire sets are compared.

Wall time and memory usage was measured by /usr/bin/time. The analysis was performed on an Apple Mac Mini M1 (2020) with 16GB RAM.

Benchmarking

The AIRR overlap functionality of CompAIRR has been thoroughly benchmarked against similar tools. All data, scripts, and results are available in a separate CompAIRR benchmarking repository.

Tips

If computer memory is limited, the dataset may be split into blocks before running CompAIRR on each block separately. Results then needs to be merged together again afterwards. This may be achieved with a simple script. We will consider providing such a script.

Development team

The code has been developed by Torbjørn Rognes based on code from Swarm where Frédéric Mahé and Lucas Czech made important contributions. Geir Kjetil Sandve had the idea of developing a tool for rapid repertoire set comparison. Lonneke Scheffer has tested and benchmarked the tool, and suggested new features. Milena Pavlovic and Victor Greiff have also contributed to the project.

Support

We will prioritize fixing important bugs. We will also try to answer questions, improve documentation and implement suggested enhancements as time permits. As we have no dedicated funding for this project we cannot make any guarantees on the level of support.

To report a potential bug, suggest enhancements or ask questions, please use one of the following means:

If you would like to contribute with code you are most welcome to submit a pull request.

Citing CompAIRR

Please cite the following if you use CompAIRR in any published work:

  • Rognes T, Scheffer L, Greiff V, Sandve GK (2021) CompAIRR: ultra-fast comparison of adaptive immune receptor repertoires by exact and approximate sequence matching. Bioinformatics, btac505. doi: 10.1093/bioinformatics/btac505

The article is also available in preprint form:

  • Rognes T, Scheffer L, Greiff V, Sandve GK (2021) CompAIRR: ultra-fast comparison of adaptive immune receptor repertoires by exact and approximate sequence matching. bioRxiv, 2021.10.30.466600. doi: 10.1101/2021.10.30.466600

References

  • Emerson RO, DeWitt WS, Vignali M, Gravley J, Hu JK, Osborne EJ, Desmarais C, Klinger M, Carlson CS, Hansen JA, Rieder M, Robins HS (2017) Immunosequencing identifies signatures of cytomegalovirus exposure history and HLA-mediated effects on the T cell repertoire. Nature Genetics, 49 (5): 659-665. doi: 10.1038/ng.3822

  • Mahé F, Czech L, Stamatakis A, Quince C, de Vargas C, Dunthorn M, Rognes T (2021) Swarm v3: Towards Tera-Scale Amplicon Clustering. Bioinformatics, btab493. doi: 10.1093/bioinformatics/btab493

About

Comparison of Adaptive Immune Receptor Repertoires

Resources

Stars

0 stars

Watchers

0 watching

Forks

Releases

Packages

Contributors

Languages