Skip to content

Latest commit

 

History

17 Commits

Folders and files

NameName
Last commit message
Last commit date
 
 
 
 
 
 
 
 

Repository files navigation

adapter4srna

Adapter in small RNA sequencing

This is an open access reporitory to collect all used adapter sequences in currently commercial available and discontinued kits.

Any comments and contributions are welcomed.

3' adapter for small RNA sequencing on Illumina platform

Vendor Kit Version 3' Adapter sequence
New England Biolabs NEBNext Multiplex Small RNA Library Prep Kit for Illumina V3 5'-AGATCGGAAGAGCACACGTCT-3'
Illumina TruSeq Small RNA Version 5’-TGGAATTCTCGGGTGCCAAGG-3'
PerkinElmer NEXTflex Small RNA Sequencing Kit ** V3 5’-TGGAATTCTCGGGTGCCAAGG-3'
Qiagen QIAseq miRNA Library Kit Version 5’-AACTGTAGGCACCATCAAT-3'
Lexogen Small RNA-Seq Library Prep Kit Version 5’-TGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC-3'
SeqMatic TailorMix miRNA Sample Preparation Kit V2 5’-TGGAATTCTCGGGTGCCAAGG-3'
Takara SMARTer smRNA-Seq Kit for Illumina Version 5’-AAAAAAAAAA-3'
TriLink CleanTag Small RNA Library Prep Kit Version 5'-TGGAATTCTCGGGTGCCAAGG-3'
Diagenode CATS small RNA-seq Kit Version 5'-GATCGGAAGAGCACACGTCTG-3'
GenXPro TrueQuant SmallRNA Seq Kit for Ultra Low Input Version TODO
Epicentre ScriptMiner Small RNA-Seq Library Preparation Kit Version ~~ ~~
Life Technology SREK, Small RNA Expression Kit version C ~~ ~~

**4 random bases

Kit Discontinued kit

CATS Small RNA sequencing kit for Illumina

Version 2 | 01.17

cutadapt -u 3 input_file.fastq | cutadapt -a AAAAAAAA - | cutadapt -a AAAAAAAN$ -a AAAAAAN$ -a AAAAAN$ - | cutadapt -a AGAGCACACGTCTG - | cutadapt -O 8 -g GTTCAGAGTTCTACAGTCCGACGATCNNN - | cutadapt -m 18 -o output_file.fastq -

Version 2 | 03.17

cutadapt -u 3 input_file.fastq | cutadapt -a AAAAAAAA - | cutadapt -a AAAAAAAN$ -a AAAAAAN$ -a AAAAAN$ - | cutadapt -a AGAGCACACGTCTG - | cutadapt -O 8 -g GTTCAGAGTTCTACAGTCCGACGATCNNN - | cutadapt -m 18 -o output_file.fastq -

Version 2 | 09.17

cutadapt --trim-n -a GATCGGAAGAGCACACGTCTG -a AGAGCACACGTCTG <input.file> | cutadapt -u 3 -a A{100} --no-indels -e 0.16666666666666666 - | cutadapt -O 8 --match-read-wildcards -g GTTCAGAGTTCTACAGTCCGACGATCSSS -m 18 -o <output.file> -

Contributing

Any comments and contributions are welcome. Pull requests are welcome.

About

3'Adapter in small RNA sequencing

Topics

Resources

Stars

8 stars

Watchers

1 watching

Forks

Releases

Packages

Contributors