Skip to content

results not matching data and changing the -sc not working #3

Description

@splaisan

The dmel example command works so your code is apparently OK

BUT

I have no results with my data and the default (1kb) while the data supports counts; additionally, I added -sc 100 but the csv file is still showing 1kb intervals.

I suspected a parsing problem due to maybe the pipes in my scaffold names and changed the pipes| to _ without improvement. I also added 1 to the end coordinate to not have 0-length and no better.
I am lost! my columns match your dme demo file which works out ...
Does the content of the last field matter? what is counted by Density, the footprint (base number) on the chromosome or the number of rows intersecting the interval?

DensityMap.pl -i motifs.gff -o F1_modified_base.svg -ty "modified_base=fused" -sc 100

# head of the csv
sequence        feature start   end     density
000029F|arrow   modified_base   0       1000    0
000029F|arrow   modified_base   1000    2000    0
000029F|arrow   modified_base   2000    3000    0
000029F|arrow   modified_base   3000    4000    0
000029F|arrow   modified_base   4000    5000    0
000029F|arrow   modified_base   5000    6000    0
000029F|arrow   modified_base   6000    7000    0
000029F|arrow   modified_base   7000    8000    0
000029F|arrow   modified_base   8000    9000    0

The input data

##gff-version 3
##source ipdSummary v2.0
##sequence-region 000029F|arrow 1 156279
000029F|arrow   kinModCall      modified_base   5719    5719    42      +       .       coverage=33;context=TATCATGCCCTTGAAAATTCTTCTGGCAACAAAACAACACG;IPDRatio=3.49
000029F|arrow   kinModCall      modified_base   7070    7070    32      +       .       coverage=44;context=AAGTTGAAAAGAATCAACGAACTTAACAATAAACTGAGGAA;IPDRatio=2.63
000029F|arrow   kinModCall      modified_base   7233    7233    33      +       .       coverage=46;context=ATTTTATAGAGGGTTTGAAAAATGCTCAAAAAAATAGCCAA;IPDRatio=2.81
000029F|arrow   kinModCall      modified_base   7435    7435    31      +       .       coverage=42;context=CGGTAATCTTATCTTTATTGTTAGACTTCGCAGAAATTTCC;IPDRatio=2.55
000029F|arrow   kinModCall      modified_base   7440    7440    31      -       .       coverage=35;context=CTAAAGGAAATTTCTGCGAAGTCTAACAATAAAGATAAGAT;IPDRatio=2.90
000029F|arrow   kinModCall      modified_base   7540    7540    42      -       .       coverage=38;context=TAGCGAACTATACCTAAAAGGGTGGGCATTGGTTAACATTA;IPDRatio=2.76
000029F|arrow   kinModCall      modified_base   8239    8239    32      -       .       coverage=36;context=GGATTTGGTTAGAGAAAAGCTCTTGACAATTATGAATACCA;IPDRatio=3.09
000029F|arrow   kinModCall      modified_base   8259    8259    31      +       .       coverage=49;context=AGCTTTTCTCTAACCAAATCCTTCAACATTGTTTTATCTAC;IPDRatio=2.47
000029F|arrow   kinModCall      modified_base   8405    8405    31      -       .       coverage=40;context=AACTGTTAATCTTCGTATCGAGTGATGTGTTAGAAGCGTTG;IPDRatio=2.90
000029F|arrow   kinModCall      modified_base   8560    8560    36      +       .       coverage=46;context=TGAAAGCCTAGCTAAAGTTCTCTGGTCGTGCAACATTCGAG;IPDRatio=3.86

Any idea what is wrong with my analysis?
Thanks

Activity

Sign up for free to join this conversation on GitHub. Already have an account? Sign in to comment

Metadata

Metadata

Assignees

No one assigned

    Labels

    No labels
    No labels

    Projects

    No projects

      Milestone

      No milestone

      Relationships

      None yet

      Development

      No branches or pull requests

      Issue actions